Sunday, December 18, 2016

A large palindrome in Mycobacterium leprae

I have found a number of sizable palindromes in Mycobacterium leprae Br4923. I report two here.

The larger one is 74 bases long:

GGTGCTTGTTTTGCAATCTCGACCATTACCTGGCCTTAAGGCCAGGTAATGGTCGAGATTGCAAAACAAGCACC

This is a true palindrome (in that the reverse complement of the sequence exactly equals the sequence). It occurs precisely once (hence is not a CRISPR) in pseudogene MLBr01586, which appears to be an analog of M. tuberculosis soluble secreted antigen MPT53. The pseudogene in question, of length 489 bases, is flanked on one side by a pseudogene that appears to be an analog of a 23S rRNA methyltransferase, and on the other side by a pseudogene that is an analog of a putative "integral membrane protein."

MLBr01586 has a G+C content of 56.4%. The pseudogenes on either side of it have G+C contents of 59% and 60%.

The palindrome is long enough to fold back on itself to produce a hairpin-like secondary structure of substantial size. Its function, if any, is of course unknown.

A palindrome of length 60 can be found in pseudogene MLBr00038:

TACCTTGGTTAGGGCATAGCCGCTGTGCAGCTGCACAGCGGCTATGCCCTAACCAAGGTA

MLBr00038 has a G+C content of only 47% and appears to be an analog of Type VII secretion protein EccE from Mycobacterium malmoense (and others), which has a G+C content of 72%.

The rather advanced AT shift of the pseudogenes is consistent with runaway accumulation of random mutations. The existence of long, intact palindromes in the midst of such mutational mayhem is surprising, leading one to wonder whether secondary structure is preferentially conserved in pseudogenes, even as codons degrade. Indeed, maybe that's one reason why the pseudogenes continue to exist after an estimated 9 to 20 million years. Their secondary structures are needed.

19 comments:

  1. Packers and Movers Bangalore for 100% Affordable and Professional Packers and Movers in Bangalore. Compare Charges of Movers and Packers, Household Shifting Services at. Packers And Movers Bangalore

    ReplyDelete
  2. Packers and Movers Bangalore for 100% Affordable and Professional Packers and Movers in Bangalore. Compare Charges of Movers and Packers, Household Shifting Services at. Packers And Movers Bangalore

    ReplyDelete
  3. An awesome post “thanks” for mentioning YOUR BRAND in your excellent article.
    Cochin Shipyard Recruitment 2017

    ReplyDelete
  4. I must say you had done a tremendous job,I appreciate all your efforts.Thanks alot for your writings......Waiting for a new 1...Please visit our wonderful and valuable website:
    Packers And Movers Chennai

    ReplyDelete
  5. Thanks for this blog. provided great information. All the details are explained clearly with the great explanation. Thanks for this wonderful blog. Step by step processes execution are given clearly.Know the details about different thing.
    Latest Jharkhand Govt jobs

    ReplyDelete
  6. Really Good blog post.provided a helpful information.I hope that you will post more updates like this.
    Navy jobs 2017-18

    ReplyDelete
  7. Good post and thanks for the information shared and this make me to visit your portal again, also checkout Bank job updates

    ReplyDelete
  8. Excellent Post...I must thank you for this informative news....
    This is my first time go to see at here and i am really pleassant to read
    all at one place
    Packers and Movers Mumbai

    ReplyDelete
  9. Excellent Post...I must thank you for this informative news....
    This is my first time go to see at here and i am really pleassant to read
    all at one place
    Packers and Movers Mumbai
    Packers And Movers Mumbai to Hyderabad

    ReplyDelete
  10. Thank for the good topic,Thanks for your sharing.

    ดูหนังออนไลน์

    ReplyDelete
  11. Hey, you now can download writing apps for ipads here and use them to benefit your writing skills!

    ReplyDelete
  12. You indicated elsewhere regarding the war on cancer: approximately $500 billion in 2012 dollars spent since Nixon declared war, at http://bigthink.com/devil-in-the-data/the-never-ending-war-on-cancer. Just wondering where you got this statistic (I would like to cite it for a research paper). Thanks. Nat Pernick, NatPernick@gmail.com (I cannot find another way to contact you other than this comment)

    ReplyDelete

Add a comment. Registration required because trolls.